Vol. 9, Special Issue 8, Part B (2025)
Designing and construction of a single guide RNA targeted to the α-Subunit of the β-Conglycinin allergen through the CRISPR/Cas9 approach in soybean
Tanavhi Aware, Pravin Jadhav, Umesh Shinde, Gopika Mote, Ruchika Bhagat, Akshay Wandhare, Sarvesh Tanpure, Mangesh Moharil, Rupesh Deshmukh, Satish Nichal, TH Rathod and Shyamsunder Mane
Soybean (Glycine max) is a major source of plant-based protein worldwide; however, its utility is limited by the presence of allergenic storage proteins such as β-conglycinin. The α-subunit of β-conglycinin, encoded by the 7S1 gene family, is a principal allergen contributing to adverse reactions in sensitive individuals. The present study aimed to design and construct a CRISPR/Cas9-based gene editing vector containing a single guide RNA (sgRNA) specifically targeting the 7S1 allergenic subunits. A conserved 20-nucleotide sgRNA sequence (GTAATCAGCGTCAGCATGGTTGG) was selected using CRISPR-P 2.0 and CRISPR-GE platforms to target multiple isoforms of the 7S1 gene family simultaneously. The sgRNA oligonucleotides were synthesized with AarI-compatible overhangs, annealed, and ligated into the pDIRECT_22A binary CRISPR/Cas9 vector through Golden Gate Assembly. Competent Escherichia coli DH5α cells were transformed with the ligation mixture and screened using blue-white selection. Recombinant (white) colonies were further verified by colony PCR using sgRNA-specific primers, which amplified a distinct 425 bp product, confirming successful integration of the sgRNA cassette. This study demonstrates the successful design and molecular construction of a CRISPR/Cas9 expression plasmid targeting the allergenic 7S1 subunit in soybean. The developed construct lays the foundation for future genome editing experiments in soybean aimed at reducing allergenicity and improving the safety of soy-based foods.
Pages: 108-115 | 505 Views 206 Downloads

